Geography, 01.09.2020 20:01 jessv01

∠A and \angle B∠B are vertical angles. If m\angle A=(x+23)^{\circ}∠A=(x+23) ∘ and m\angle B=(5x-9)^{\circ}∠B=(5x−9) ∘ , then find the measure of \angle B∠B.

Answers: 2

Show answers

Another question on Geography

Geography, 23.06.2019 09:00

8. compare the education of a sparta boy and an athenian boy. (2 points)

Answers: 2

Answer

Geography, 23.06.2019 09:00

Hey, i was what is consisted in a sustainable city? like what unique designs they have, etc. for answering ; )

Answers: 3

Answer

Geography, 23.06.2019 09:00

What was on result of the potato famine

Answers: 1

Answer

Geography, 23.06.2019 11:30

Fertility and mortality rates are higher in more developed nations.

Answers: 3

Answer

You know the right answer?

∠A and \angle B∠B are vertical angles. If m\angle A=(x+23)^{\circ}∠A=(x+23) ∘ and m\angle B=(5x-9)^{...

Questions

Mathematics, 21.09.2021 21:40

4275 divided by 28 step by step...

Chemistry, 21.09.2021 21:40

A solid will float on any liquid that is more dense than it is. The volume of a piece of amber is 50.0 mL, and the mass is 54.0 g. On which of the fol...

Engineering, 21.09.2021 21:40

The members of truss are pin- connected at joint O as shown in figure. Determine the magnitude of F, and F2 for equilibrium.[Ans: F1 =3.59 kN , F2 =...

History, 21.09.2021 21:40

According to Alan ward, what barries might have kept Romans from voting?...

Advanced Placement (AP), 21.09.2021 21:40

Which of the following is one of the reasons why the study of population geography is especially important? Group of answer choices Virt...

Mathematics, 21.09.2021 21:40

HELP LAST ATTEMPT !! ...

Chemistry, 21.09.2021 21:50

ANSWER ASAP WILL GIVE imagine that you are a chemist in the early 1900's who works for a lab that synthesizes aspirin from salicylic acid. Write an...

Mathematics, 21.09.2021 21:50

4x^2(x-2)-9(x-2)=(x-2)( ? )...

History, 21.09.2021 21:50

Examine the dates in this timeline: 1757 1813 1848 1857 1877 1757: British troops overthrow the native governmen...

Business, 21.09.2021 21:50

Cox Company has the following stockholders' equity section of its balance sheet on January 1: Additional Resources Cox Company Stockholders' Equity Ja...

Mathematics, 21.09.2021 21:50

What is the terms in this expression, 5 - 4x - 8...

Arts, 21.09.2021 21:50

RIGHT ANSWER GETS BRAINLIEST What is Form? 1.A mark that has a length and direction 2.Shape with height, width, and depth 3....

Mathematics, 21.09.2021 21:50

RatiosAt the ice cream shop, there are 14 shakes sold for every 6 malts. Record the ratio below:Malts to Shakes...

Chemistry, 21.09.2021 21:50

PLZ HELP M Explain why the skater must be at a specific height at the start to make it successfully to the end of the ramp. Be sure to use the terms...

Mathematics, 21.09.2021 21:50

a laptop cost $600 in 2017, was worth #300 in 2019, $175 in 2020, and only $100 in 2021. each figure is for the first day of each year (jan). what is...

Mathematics, 21.09.2021 21:50

What will drink 3 taste like in comparison to drink 2? a Drink 3 will taste more sweet. b Drink 3 will taste the same as drink Dri...

Mathematics, 21.09.2021 21:50

What is the effect on the graph of the function f(x) = IXI when f(x) is changed to f(x + 9)? A) shifts right by 9 units B) shifts...

Biology, 21.09.2021 21:50

What would be the primary structure of this small protein made from the following DNA sequence? TACTCTGATAATGCCGTCATT

English, 21.09.2021 21:50

Please someone help me ...

Mathematics, 21.09.2021 21:50

Draw the dilation image A'B'C'D' of the trapezoid ABCD with the center of the dilation at the origin and the scale factor -2. Include the original tra...

More questions: Geography Another questions