English, 16.03.2022 23:40 shmueller1554

1. Karim plans to spend 3 times the amount he gets from the sale of his old bike to buy his new bike. a. How much money must Karim get for his old bike if he decides to buy bike A? Draw a bar diagram and write an equation to represent the problem. Does this situation use addition or multiplication to compare? (2 points)

Answers: 2

Show answers

Another question on English

English, 21.06.2019 16:00

Which option best characterizes the pardon-seller?

Answers: 1

Answer

English, 21.06.2019 22:00

My friends asked me, “are you not coming for the party? "change into passive voice

Answers: 2

Answer

English, 22.06.2019 08:30

How would the play the still alarm have been different if it was not a parody and the characters reacted normally to the fire in the hotel?

Answers: 3

Answer

English, 22.06.2019 10:00

What reasons does the author give to support the claim that it is difficult for a message to move people to take action?

Answers: 3

Answer

You know the right answer?

1. Karim plans to spend 3 times the amount he gets from the sale of his old bike to buy his new bike...

Questions

English, 07.01.2021 06:00

You Do (Independent Work) (x, 1x19=209) Lindsey earns $11 per hour tutoring math students. This week she worked 19 hours. Vinich statemen...

English, 07.01.2021 06:00

How can we say that junk food has become a global culture....

History, 07.01.2021 06:00

16. Which of the Olympian gods did not spend much time on Mount Olympus?...

English, 07.01.2021 06:00

. (You are your own CNI X What have I learned about the X Grc s/d/e/1FAIpQLSCOJOR23nXTNZ0a7otPHZh mv8eDZRGmosB151v5HqPg The loss o...

Biology, 07.01.2021 06:00

AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three d...

Mathematics, 07.01.2021 06:00

Lin’s teacher uses a box to store her set of cubes with an edge length of 1/2 inch if the box is completely full how many cubes are in the set?...

Social Studies, 07.01.2021 06:00

I need help for this ...

Mathematics, 07.01.2021 06:00

Hailey has a 5foot long extension...

Social Studies, 07.01.2021 06:00

Someone help me please ...

Social Studies, 07.01.2021 06:00

WORTH 75 POINTS IN 15HRS MARKING BRAINLIST QUESTION 1This program consists of three lottery-funded scholarships for Florida high school g...

Mathematics, 07.01.2021 06:00

It takes 18 hours to fill a pool using 8 garden hoses. How long would it take to fill the same pool using 9 garden hoses? (Answer is definitely NOT 20...

English, 07.01.2021 06:00

What objects could represent time in chapter 5 of the great gatsby? What happens to these objects? What is the author communicating about time?...

Mathematics, 07.01.2021 06:00

Friends who want report? im a girl bf?...

Physics, 07.01.2021 06:00

CAN SOMEONE PLEASE HELP ME I DON'T UNDERSTAND ...

Mathematics, 07.01.2021 06:00

Answers for both boxes please ...

English, 07.01.2021 06:00

In the chart, identify the text structure(s) used in the reading selection "Collecting Rocks." Complete the chart by including signal words you read....

Arts, 07.01.2021 06:00

Why did Chuck Close influence 4 others to paint art which became apart of our U. S. history?...

Mathematics, 07.01.2021 06:00

PLEASE HELP MEEE A rocket carrying fireworks is launched from a hill 80 feet above a lake. The rocket will fall into the lake after exploding a...

Mathematics, 07.01.2021 06:00

7/8 divided by 1/8 pluse 2by the power of 2...

Mathematics, 07.01.2021 06:00

Rajan had 30 dollars to spend on 3 gifts. He spent 9 1 4 dollars on gift A and 5 4 5 dollars on gift B. How much money did he have left for gift C?...

Another questions