subject

Chemistry, 09.03.2020 16:14 mt137896

If 21.1 mL of the barium hydroxide solution was needed to neutralize a 3.89 mL aliquot of the perchloric acid solution, what is the concentration of the acid?

ansver

Answers: 1

Show answers

Another question on Chemistry

question

Chemistry, 22.06.2019 18:30

Iwould appreciate if someone could me.

Answers: 2

question

Chemistry, 22.06.2019 20:30

Calculate the percent composition by mass of each element in al(oh)3. use at least three significant figures.

Answers: 1

question

Chemistry, 23.06.2019 00:00

Which is true about metals used for jewelry, such as platinum and gold? a. they have low flammability. b. they have low reactivity. c. they have high flammability. d. they have high reactivity.

Answers: 1

question

Chemistry, 23.06.2019 01:00

You wish to prepare a buffer consisting of acetic acid and sodium acetate with a total acetic acetate plus acetate concentration of 250 mm and a ph of 5. what concentrations of acetic acid and sodium acetate should you use

Answers: 1

You know the right answer?

If 21.1 mL of the barium hydroxide solution was needed to neutralize a 3.89 mL aliquot of the perchl...

Questions

question

Chemistry, 26.05.2021 08:20

Z00 M, id: 3940892861,P:1234❤s e x lo ve rs j o i n ❗...

question

History, 26.05.2021 08:20

How do you think the Great Depression should have been handled by the President? What would you have done? The Great Depression...

question

Mathematics, 26.05.2021 08:20

Find the area of the given equilateral triangle...

question

Biology, 26.05.2021 08:20

Write the tRNA sequence for the given strand of mRNA 7. AGGUCAUGCAUGGGCAUGCAU 8.AGAGAUUCAGCUAGCACGAUA I...

question

Mathematics, 26.05.2021 08:20

FREE PTS!You go at red and you stop at green. What am I?...

question

Mathematics, 26.05.2021 08:20

A regular octagon can be divided into eight congruent triangles with base angles that are age 67.5°. This octagon has a side length that is 8 cm. What...

question

Social Studies, 26.05.2021 08:20

Help me please y’all ahhh omggg please ...

question

Physics, 26.05.2021 08:20

A weight lifter does 700J of work on a weight that he lifts in 3.1s. What is the power with...

question

Social Studies, 26.05.2021 08:20

An investigator was interested in the effects of various treatments on reduction of fear in phobic participants. He suspected that type of phobia may...

question

Mathematics, 26.05.2021 08:20

Using the 45o −45o −90o Triangle theorem.Solve this triangle.

question

Mathematics, 26.05.2021 08:20

A rocket is launched from a tower . The height of the rocket , y in feet, is related to the time after launch, in seconds , by the given equation. Usi...

question

Chemistry, 26.05.2021 08:20

17 moles of oxygen is equal to...

question

Biology, 26.05.2021 08:20

Mr. Robert originates from Switzerland and now lives in Malaysia. Mr. Robert works as a diplomatic officer. He finds that his daily food requirements...

question

Mathematics, 26.05.2021 08:20

Hi i have answers but i don't have the workings can someone help lol

question

Biology, 26.05.2021 08:20

The following statements refer to events that happen following infection with HIV, leading to the onset of AIDS. 1. The body becomes immunocomp...

question

Mathematics, 26.05.2021 08:20

What is the present value of 6000 received 14 years from today when the interest rate is 10%...

question

Mathematics, 26.05.2021 08:20

Write this expression in simplest form. 256h^10...

question

Mathematics, 26.05.2021 08:20

Mason was offered a job that paid a salary of $98,000 in its first year. The salary was set to increase by 3% per year every year. If Mason worked at...

question

Mathematics, 26.05.2021 08:20

Can anyone answer this with workings pls? ...

question

Computers and Technology, 26.05.2021 08:20

1. Which of the following is a new generation optical storage device? CD DVD Blu-ray disc Pen drive...

More questions: Chemistry Another questions

Questions on the website: 13722360