subject
Biology, 23.07.2019 23:30 mariah16powell

How is the oxygen cycle disturbed by deforestation? a. runoff decreases. b. evaporation increases. c. photosynthesis decreases. d. precipitation increases.

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 04:10
What noticeable trend from this graph might be used to make a conclusion?
Answers: 1
question
Biology, 22.06.2019 08:00
Can create a hboth of these instruments can measure wind speed. doppler radar and psychrometer anemometer and hygrometer doppler radar and anemometer radiosonde and psychrometer
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:00
What could happen if two base pairs on a strand of dna or switched
Answers: 3
You know the right answer?
How is the oxygen cycle disturbed by deforestation? a. runoff decreases. b. evaporation increases....
Questions
question
Mathematics, 09.02.2021 14:00
question
Geography, 09.02.2021 14:00
question
Physics, 09.02.2021 14:00
question
Mathematics, 09.02.2021 14:00
question
Mathematics, 09.02.2021 14:00
Questions on the website: 13722363