subject
Biology, 25.07.2019 02:30 stephaniem0216

Nwhat organelle would you find acetyl coa formation, the citric acid cycle, and the electron transport chain?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 03:30
Glucose is broken down in different ways, both in the presence and in the absence of oxygen. using the table for reference, what major products are formed in each reaction set?
Answers: 1
question
Biology, 22.06.2019 06:40
Migration is a. the movement of organisms from a native location to a foreign location b. the movement of organisms from a foreign location to a native location the movement of organisms from their water supply to their food supply d. the seasonal movement of organisms between locations c. select the best answer from above
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
Abody cell has been growing and at synthesis proteins.in the nucleus of this body cell,dna replication is taking place. and a copy of the cells genetic material is copied.which of the following is the best conclusion you can make about the life cycle of this cell ? a) the cell is ready to undergo mitosis.and a chemical signal will send the cell to prophase b)the cell is undergoing meiosis and will cross over the genetic material next c)the cell is in the s phase of interphase and will move next to the g2 phase d) the cell is in the g2 phase of the interphase and is ready to begin diving
Answers: 1
You know the right answer?
Nwhat organelle would you find acetyl coa formation, the citric acid cycle, and the electron transpo...
Questions
question
Mathematics, 12.02.2021 18:50
question
Mathematics, 12.02.2021 18:50
question
Mathematics, 12.02.2021 18:50
question
Mathematics, 12.02.2021 18:50
question
Mathematics, 12.02.2021 18:50
question
Mathematics, 12.02.2021 18:50
question
History, 12.02.2021 18:50
Questions on the website: 13722359