![subject](/tpl/images/cats/biologiya.png)
Biology, 26.07.2019 20:30 chonawilson4
In which phase is the full illumination face of the moon visible on earth a: new moon b: full moon c: waning gibbous d: waxing crescent
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:20
Which of the following statements most accurately describes convergent evolution? the process in which two similar species evolve separately from each other and share similar characteristics the process in which a single species evolves into two or more new species the process in which two entirely different species evolve in response to each other the process in which two different species evolve separately from each other but still share similar characteristics
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 05:00
What organ systems are working to you cool down after a workout?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:00
Use the above pedigree for questions 1,2, and 3 1. what kind of genetic disorder is represented in the pedigree? a. recessive b. dominate refer to the pedigree in question 1. 2. is the mutated gene in this disorder located on a sex chromosome (x or y) or an autosome? a. sex chromosome b. autosome refer to the pedigree in question 1. 3. which generation has individuals that you are certain are heterozygous for the mutated gene? a. generation 1 b. generation 2 c. generation 3
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
In which phase is the full illumination face of the moon visible on earth a: new moon b: full moon...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/istoriya.png)
History, 13.06.2020 23:57
![question](/tpl/images/cats/mkx.png)
Arts, 13.06.2020 23:57
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/istoriya.png)
History, 13.06.2020 23:57
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/fizika.png)
Physics, 13.06.2020 23:57
![question](/tpl/images/cats/en.png)
English, 13.06.2020 23:57
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/es.png)
Spanish, 13.06.2020 23:57
![question](/tpl/images/cats/es.png)
Spanish, 13.06.2020 23:57
![question](/tpl/images/cats/mat.png)
Mathematics, 13.06.2020 23:57