Answers: 1
Biology, 21.06.2019 18:10
What is unique about the members of the group of fungi to which penicillium notatum belongs? they are not important for medicine. they are not made up of hyphae. they are used in fermentation. they lost the reproductive phase.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:00
Mrna: gcuaauguc what amino acids does the mrna above code for? what type of amino acids or function are uag, uga, and uaa coding for? which codon (3 letters) signals translation to start and also codes for the amino acid methionine (met)?
Answers: 1
Why are the cells in a multicellular organism organized into tissue...
History, 22.07.2019 11:00
Social Studies, 22.07.2019 11:00
Computers and Technology, 22.07.2019 11:00
Biology, 22.07.2019 11:00
Chemistry, 22.07.2019 11:00
Chemistry, 22.07.2019 11:00