Answers: 1
Biology, 21.06.2019 15:00
Dna is the genetic material that makes up living things, and folic acid plays an important role in the information of dna. jon wants to study the effect of folic acid on dna formation in microbes. which statement accurately describes the variables in this study
Answers: 2
Biology, 21.06.2019 15:30
*will mark brainliest to first correct answer* photosynthesis led to increasing levels during the later proterozoic eon? a. oxygen b. water c. carbon dioxide d. none of the above
Answers: 2
Biology, 22.06.2019 06:40
The steps in the formation of extrusive igneous rocks are listed below in an incorrect order: 1. rock melts due to high temperature. 2. rock is buried deep under earth's surface. 3. magma is forced out of earth's surface during volcanic eruption. 4. lava cools and crystallizes to igneous rock. which of these best shows the correct order of steps in the formation of extrusive igneous rocks? 1, 3, 4, 2 2, 1, 3, 4 3, 4, 2, 1 4, 2, 1, 3
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Survival on land for organisms is difficult because of the problem of...
Social Studies, 14.10.2019 01:30
English, 14.10.2019 01:30
Geography, 14.10.2019 01:30
Business, 14.10.2019 01:30
Chemistry, 14.10.2019 01:30
Physics, 14.10.2019 01:30
Chemistry, 14.10.2019 01:30
Mathematics, 14.10.2019 01:30
Computers and Technology, 14.10.2019 01:30
Biology, 14.10.2019 01:30