![subject](/tpl/images/cats/biologiya.png)
Biology, 02.08.2019 04:00 Marqiuse412
Acertain segment of dna can be used as a molecular clock. its rate of mutation is one mutation per 10 million years. examine the dna segments from two different species: species a: cttaagctagtaaggacc species b: cataagttagtaaggtcc using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor. be sure to answer this question in paragraph form using complete sentences.
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:30
Imagine ? person stepping on a pin and pulling his or her foot way look at the réfléchir arc of the scenarios below
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
You know the right answer?
Acertain segment of dna can be used as a molecular clock. its rate of mutation is one mutation per 1...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 30.07.2019 15:00
![question](/tpl/images/cats/mkx.png)
Arts, 30.07.2019 15:00
![question](/tpl/images/cats/geografiya.png)
Geography, 30.07.2019 15:00
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/fizika.png)
Physics, 30.07.2019 15:00
![question](/tpl/images/cats/mat.png)
Mathematics, 30.07.2019 15:00
![question](/tpl/images/cats/istoriya.png)
History, 30.07.2019 15:00
![question](/tpl/images/cats/en.png)
English, 30.07.2019 15:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/health.png)
Health, 30.07.2019 15:00
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 30.07.2019 15:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 30.07.2019 15:00
![question](/tpl/images/cats/nemec.png)
German, 30.07.2019 15:00