To which of the following dna sequences would the tata box binding protein bind? a. taggcgtatatagcgccttat b. cccgttaattaattaacgcgc c. gcgcttatctattaccgtacg d. atcgattccgatactatgcta

The gene that causes sickle-cell disease is present in a higher percentage of residents of sub-saharan africa than among those of african descent living in the united states. even though this gene causes sickle-cell disease, it also provides some protection from malaria, a serious disease that is widespread in sub-saharan africa but absent in the united states. discuss an evolutionary process that could account for the different percentages of the sickle-cell gene among residents of the two regions.

Name the glands associated with human digestive system

Research cheetahs on the internet what has contributed to this animal becoming "endangered" or "threatened." what animal you have chosen? -cheetah how long has the animal been endangered or threatened? what has contributed to this animal’s endangered or threatened status? why is it important to save this animal from extinction? after researching and gathering facts, write a 350-word letter from the point of view of an animal rights' activist. be sure to include at least five facts that you learned from your research.