subject
Biology, 03.08.2019 21:30 Jasoncookies23

Which type of animals are able to maintain an internal body temperature by producing energy through metabolic processes within cells?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 03:30
Which statement best describes a typical difference that could be found between the "analysis" and "conclusion" sections of a lab report? a) only the "conclusion" describes errors that occurred during the experiment, and only the "analysis" section suggests further research.b) only the "analysis" section includes specific data comparisons, and only the "conclusion" section suggests further research.c) only the "analysis" section discusses whether the original hypothesis was supported, and both sections include graphs of data.d) only the "conclusion section discusses whether the original hypothesis was supported, and both sections suggest further research.(the answer is b i just took the test)
Answers: 1
question
Biology, 22.06.2019 06:30
What molecule does hemoglobin decay into over time
Answers: 1
question
Biology, 22.06.2019 10:00
Asegment of dna that codes for rna and a protein is a
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which type of animals are able to maintain an internal body temperature by producing energy through...
Questions
question
Chemistry, 23.10.2020 03:01
question
Mathematics, 23.10.2020 03:01
question
Health, 23.10.2020 03:01
Questions on the website: 13722360