subject
Biology, 02.10.2019 02:30 itsjusmika

Describe how enzymes affect chemical reactions and explain why this makes enzymes important to living thing

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 03:00
Which of the following is the best definition for the process of photosynthesis? a.) plants digest sugars to make energy. b.) plants use oxygen and glucose to make carbon dioxide. c.) plants use sunlight and carbon dioxide to make sugars. d.) plants use sunlight to make chlorophyll and chloroplasts.
Answers: 2
question
Biology, 22.06.2019 05:30
Where can dna be found in a prokaryotic cell
Answers: 2
question
Biology, 22.06.2019 06:00
Sarah and john are having a discussion on genetic diversity. sarah believes that it happen over a long period of time. john it happens immediately. who is correct? a. sarah is correct because genetic diversity occurs over a long period of time. b. john is correct because genetic diversity occurs immediately. c. both are correct because genetic variation can occur or long period of time. d. neither are correct because genetic diversity occurs over any period of time
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Describe how enzymes affect chemical reactions and explain why this makes enzymes important to livin...
Questions
question
Mathematics, 23.07.2019 00:00
question
Mathematics, 23.07.2019 00:00
Questions on the website: 13722363