subject
Biology, 19.08.2019 17:30 dontcareanyonemo

Describe how succession can restore the equilibrium of an ecosystem.

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 20:40
Question 11 which of the following personal health practices should a person follow to reduce the risk of skin cancer? avoid staying outdoors when the sun is strongest. consume antibiotics to prevent bacterial attacks. wash hands frequently to maintain proper hygiene. have a balanced diet and exercise regularly. question 12 a student wants to compare how easily a metal and a plastic spoon of the same temperature can transfer thermal energy. which of the following activities should the student perform? measure the effort required to bend each spoon. place an ice cube on each spoon and record the rate of melting of the cubes. place the spoons at room temperature and record the change in temperature of each. measure the change in weight of the spoons after placing them in the freezer for a few minutes. question 13 the characteristics of certain cell divisions are described in the following table. cell division characteristics characteristic description 1 forms diploid cells 2 creates sex cells, or gametes which type(s) of cell division do the two characteristics represent? both characteristics represent meiosis. both characteristics represent mitosis. characteristic 1 represents meiosis and characteristic 2 represents mitosis. characteristic 1 represents mitosis and characteristic 2 represents meiosis. question 14 which of the following adaptations in wooly mammoths could have best prevented their extinction? shedding of fur darker color of fur growth of an extra layer of fur increase in the thickness of fur question 15 maria and ben are both suffering from a hereditary disease, as described in the following table. description of disease patient description maria blood cells get stuck in blood vessels, causing painful attacks ben hemoglobin is abnormal due to curved shape of red blood cells which disease(s) are maria and ben suffering from? both are suffering from type 1 diabetes. both are suffering from sickle cell anemia. maria is suffering from sickle cell anemia and ben from type 1 diabetes. maria is suffering from type 1 diabetes and ben from sickle cell anemia. question 16 which of the following icons is used to represent a female carrier of a disease? a half-filled circle a half-filled square a completely filled circle a completely filled square question 17 joe sowed seeds of a plant in two different types of soil in separate pots. she added the same amount of fertilizer to the pots. she then placed the pots in the sun and recorded their growth after four days. what is the independent variable in the study? duration of growth amount of fertilizer growth of seeds type of soil question 18 philip has curly hair and his sister has straight hair. which of the following explains why philip and his sister have different hair types? both children received the same hair coding gene from their mother. both children received the same hair coding gene from their father. their mother was exposed to different environments before their births. the children each received different genes from their parents. question 19 which statement is most likely correct about species which cannot adapt? they become extinct. their immunity increases. their population increases. they produce more offspring. question 20 four animals live in the arctic. their characteristics are described in the following table. animal characteristics a long tail b small feet c black fur d white skin which animal is least likely to be captured by its enemies? animal a animal b animal c animal d
Answers: 3
question
Biology, 21.06.2019 23:30
Examine the two squirrel populations in the accompanying figure. the populations are separated by a geographic barrier. if after a long period of time the two species are no longer separated, what evidence is needed to determine if speciation has occurred? the figure shows two populations of squirrels separated by a geographic barrier. examine the two squirrel populations in the accompanying figure. the populations are separated by a geographic barrier. if after a long period of time the two species are no longer separated, what evidence is needed to determine if speciation has occurred? the figure shows two populations of squirrels separated by a geographic barrier. polyploidy is creating new species. the two populations are not interbreeding freely. hybrid offspring of the two populations begin to appear. one species will increase into a population size twice as large as the other species.
Answers: 2
question
Biology, 22.06.2019 10:40
Which of the following is the earliest era of earth's geologic time scale? cenozoic mesozoic precambrian paleozoic
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Describe how succession can restore the equilibrium of an ecosystem....
Questions
question
Mathematics, 30.06.2020 17:01
question
Mathematics, 30.06.2020 17:01
Questions on the website: 13722367