![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 17:20
Joe is breeding cockroaches in his dorm room. he finds that the average wing length in his population of cockroaches is 4 cm. he chooses the six cockroaches that have the largest wings; the average wing length among these selected cockroaches is 10 cm. joe interbreeds these selected cockroaches. from earlier studies, he knows that the narrow-sense heritability for wing length in his population of cockroaches is 0.6. a. calculate the selection differential and expected response to selection for wing length in these cockroaches. b. what should be the average wing length of the progeny of the selected cockroaches?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 18:10
In general, how long does it take to accomplish a long-term goal? a.a few days to a weekb.a few weeks to a monthc.a few months to a yeard. more than a year
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:30
When rutherford performed his metal foil experiment, he was surprised that most of the alpha particles
Answers: 1
You know the right answer?
Members of a virus family have the same type of nucleic acid....
Questions
![question](/tpl/images/cats/en.png)
English, 16.11.2020 23:20
![question](/tpl/images/cats/fizika.png)
Physics, 16.11.2020 23:20
![question](/tpl/images/cats/mat.png)
Mathematics, 16.11.2020 23:20
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 16.11.2020 23:20
![question](/tpl/images/cats/istoriya.png)
History, 16.11.2020 23:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 16.11.2020 23:20
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
History, 16.11.2020 23:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/health.png)
Health, 16.11.2020 23:20
![question](/tpl/images/cats/en.png)
English, 16.11.2020 23:20
![question](/tpl/images/cats/geografiya.png)
Geography, 16.11.2020 23:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 16.11.2020 23:20