Critical thinking compare the size and depth of an acetabulum of a hip bone to the glenoid cavity of the scapula

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Ascientist wanted to formulate a pill to attack a specific type of bacteria that infects the throat. which biological component would be best to use as a model for the pill's function? bacteriocytes phagocytes complement antibodies

The table above shows five different types of chromosomal abnormalities that can occur during meiosis. they result in either an individual having too many or too few chromosomes in their genome. what is the most likely cause of these chromosomal abnormalities?