![subject](/tpl/images/cats/biologiya.png)
Biology, 23.08.2019 06:30 marley462847
The desert tortoise digs a burrow and hides in it during the day to stay cool, because of the extreme heat above ground. which characteristic of life does this behavior best illustrate?
a- response
b- metabolism
c- cellular organization
d- growth and development
(my guess is a)
which statement best illustrates how an organism maintains homeostasis?
a- parents pass their traits to their offspring.
b- female barn swallows mate with long-tailed males.
c- young hawks have different kinds of feathers than adult hawks.
d-desert pack rats are active at night to conserve water. (my guess is d)
![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
The embryos of a bird, a reptile, and a mammal are similar in appearance. how does comparing the physical appearance of embryos of different species support the theory of evolution? a. it shows that these organisms share a common ancestor. b. it provides evidence that these organisms eat the same foods.c. it shows that these organisms share the same habitat.d. it provides evidence that these organisms suffered a genetic mutation.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:50
2points what do bacteria have in common with the cells of other living organisms?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
You know the right answer?
The desert tortoise digs a burrow and hides in it during the day to stay cool, because of the extrem...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 27.08.2020 07:01
![question](/tpl/images/cats/biologiya.png)
Biology, 27.08.2020 07:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.08.2020 07:01
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.08.2020 07:01
![question](/tpl/images/cats/mat.png)
Mathematics, 27.08.2020 07:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.08.2020 07:01
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/fizika.png)
Physics, 27.08.2020 07:01
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/fizika.png)
Physics, 27.08.2020 07:01
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.08.2020 07:01
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.08.2020 07:01