![subject](/tpl/images/cats/biologiya.png)
Biology, 16.01.2022 14:00 carriboneman
What rule ensures that the two DNA strands are identical to the original stand?
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 14:50
Genetic diversity is the variation in the genes of an entire species. each circle represents a population of a particular species in different habitats. select the population with maximum genetic diversity
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 22:00
An ecologist is studying the effects that a population of predators is having on a population of a prey. he used data from the field to produce this graph. which conclusion can draw from the graph?
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00
Which statement best describes how the loudness of the sound affects the high-pressure region created by the sound wave? a. a louder sound has no effect on the pressure created. b. a louder sound means a high-pressure region that is higher. c. a louder sound means a high-pressure region that is not as high.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What rule ensures that the two DNA strands are identical to the original stand?...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.07.2019 09:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.07.2019 09:00
![question](/tpl/images/cats/mat.png)
Mathematics, 05.07.2019 09:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 05.07.2019 09:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.07.2019 09:10
![question](/tpl/images/cats/istoriya.png)
History, 05.07.2019 09:10
![question](/tpl/images/cats/mat.png)
Mathematics, 05.07.2019 09:10