Biology, 13.01.2022 20:00 MagicDragon4734
Which best describes the first step in genetic engineering?
Fragments of DNA that have desired genes are isolated to form recombinant DNA for use in a host.
All the DNA from a desired organism is isolated to form recombinant DNA for use in a host.
Different sections of DNA from a desired organism are inserted into a host so that beneficial traits will be expressed.
One strand of DNA is isolated and inserted into a host so recombinant DNA can be formed.
Answers: 2
Biology, 22.06.2019 00:00
Mouse liver cells were homogenized and the homogenate subjected to equilibrium density-gradient centrifugation with sucrose gradients. fractions obtained from these gradients were assayed for marker molecules (i.e., molecules that are limited to specific organelles). the results of these assays are shown in the figure. the marker molecules have the following functions: cytochrome oxidase is an enzyme involved in the process by which atp is formed in the complete aerobic degradation of glucose or fatty acids; ribosomal rna forms part of the protein-synthesizing ribosomes; catalase catalyzes decomposition of hydrogen peroxide; acid phosphatase hydrolysis monophosphoric esters at acid ph; cytidylyltransferase is involved in phospholipid biosynthesis; and amino acid permease aids in transport of amino acids across membranes. a) name the marker molecule and give the number of the fraction that is most enriched for each of the following cell components: lysosomes; peroxisomes; mitochondria; plasma membrane; rough endoplasmic reticulum; smooth endoplasmic reticulum.
Answers: 3
Biology, 22.06.2019 01:30
How does friction with the atmosphere affect the speed of an artificial satellite
Answers: 3
Biology, 22.06.2019 04:30
Anurse is in the dining room and overhears a new nurse tell a client with body dysmorphic disorder that she's much too thin and must eat more before she can go home. the client bursts into tears and runs out of the dining room. what is the best way for the nurse to address this situation?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Which best describes the first step in genetic engineering?
Fragments of DNA that have desired gen...
English, 05.07.2019 21:00
Mathematics, 05.07.2019 21:00
Social Studies, 05.07.2019 21:00
Spanish, 05.07.2019 21:00
History, 05.07.2019 21:00
Mathematics, 05.07.2019 21:00
Mathematics, 05.07.2019 21:00
Chemistry, 05.07.2019 21:00
Mathematics, 05.07.2019 21:00
Mathematics, 05.07.2019 21:00