subject
Biology, 08.01.2022 19:00 alexisbcatlett14

What three organs secrete enzymes into the small intestines to assist in chemical digestion? A. pancreas, stomach, liver

B. liver, pancreas, gallbladder

C. pancreas, liver, stomach

D. liver, esophagus, small intestine

help me please please please please please please please please please please please please please please please please please please please please please please please please please please please

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 01:30
Hedgerows have created a new ecosystem within britain’s a. farms b. cities c. forests d. industrial areas
Answers: 1
question
Biology, 22.06.2019 08:10
What’s the student’s scientific question
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
The embryos of a bird, a reptile, and a mammal are similar in appearance. how does comparing the physical appearance of embryos of different species support the theory of evolution? a. it shows that these organisms share a common ancestor. b. it provides evidence that these organisms eat the same foods.c. it shows that these organisms share the same habitat.d. it provides evidence that these organisms suffered a genetic mutation.
Answers: 1
You know the right answer?
What three organs secrete enzymes into the small intestines to assist in chemical digestion? A. pa...
Questions
question
Mathematics, 23.07.2019 11:00
Questions on the website: 13722361