subject
Biology, 07.01.2022 02:20 CrusaderLord

What will happen if the pH is changed from 7.5 to a pH of 3?

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 20:00
Use the drop-down menu to match the following definitions to the corresponding terms. the total variety of organisms that live in the biosphere a group of organisms that breed and produce offspring that can breed all of the biotic and abiotic factors in an area
Answers: 1
question
Biology, 21.06.2019 20:00
Which of the following is true of microbes? a. ninety-nine percent of all microbes are pathogenic.b. gene expression in bacteria is very similar to gene expression in humans, which facilitates the use of bacteria in recombinant biotechnology and gene therapy.c. all bacterial enzymes are harmful to humans and the environment.d. microbes create pollutants and toxins that harm the environment.
Answers: 2
question
Biology, 21.06.2019 23:20
Ascientist wants to determine the effect of a new type of gasoline. he fillsone car with normal gasoline and another identical car with the new gasoline.which is the control group? a. the new type of gasolineb. the car with the normal gasolinec. the car with the new gasolinethe amount of gasoline usedd. the amount of gasoline used
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What will happen if the pH is changed from 7.5 to a pH of 3?...
Questions
question
Mathematics, 11.12.2020 09:50
question
Mathematics, 11.12.2020 09:50
question
Business, 11.12.2020 09:50
question
Chemistry, 11.12.2020 09:50
question
English, 11.12.2020 09:50
question
Mathematics, 11.12.2020 09:50
question
Mathematics, 11.12.2020 09:50
Questions on the website: 13722363