AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Group control group #1 experimental group yes yes yes control group #2 no new drug orange juice bed rest no yes no yes ves which of the following is the best explanation of why a second control group was included in this experiment? o a. to provide the volunteers in the study with something to drink o b. to prove that the common cold cannot be cured c. to confuse anyone who is trying to steal their new drug and sell it as their own invention o d. to researchers conclude that results are related to the new drug and not to the orange juice submit e previous

Genes that come together with different alleles are heterozygous. homozygous. genotype. segregated.

Which individual below would be considered heterozygous? a.dd b.dd c.dd