DNA message #2: GAGCGCACCATCGGGAAGCTA
Transcription:
Translation:

Amale bird-of-paradise uses a dance to attract mates in which it flaps its tail feathers on the ground and jumps around a potential female mate. a different male bird-of-paradise does a similar dance but it jumps around the female in the opposite direction. the female bird is only attracted to one style of dance, in one direction. this is an example of speciation.

The response is the basis for vaccination. primary secondary tertiary none of the above

Why did the federal government end its support of yucca mountain as a site for long-term storage of nuclear water