What is the Spitzer telescope's primary function?

Suppose you have monohybrid pea plants in your garden and find that they produce round seed to wrinkled seeds in the ratio of 3: 1. if the allele are designated (r & r) receptively. what is the probable genotypes of the round seeds which produced f 1 ? rr & rr rr only rr & rr rr only rr only

Hurry i need your (100 points) 1) what are the responsibilities of the region of the brain highlighted below? (picture located below) the highlighted portion is at the rear base of the brain, behind the brain stem. regulating homeostasis, hunger and eating, thirst and drinking, and many other functions of basic survival. coordinating movement and balance by using information from sensory nerves, including hand-eye coordination. controlling voluntary body movements, processing information from sense organs, thoughts, and learning abilities. regulating important involuntary bodily functions such as blood pressure, heart rate, breathing, and swallowing. 2)which of the following systems or structures is correctly paired with its function? neurons - brain cells that control thoughts, calculations, and memory cerebral cortex - portion of the brain that controls involuntary body movement peripheral nervous system - carries impulses to and from the central nervous system central nervous system - carries information from the nerves to the muscles and glands

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?