subject
Biology, 03.12.2021 14:00 FortniteB

Need help look at pdf/link part 5. a b and c 1. Use this sequence of DNA to answer the following former test questions:
5’-- TTAATGGGACAGCTTGTGTAGAGG --3’
a. What is the complementary strand of DNA?
b. Using the complementary strand of DNA (your answer from part a) as the template
strand, what is the transcribed mRNA sequence?
c. What is the amino acid sequence translated from the strand of mRNA synthesized in
part b (use the genetic code below)?
Remember:
i. Start codon!
ii. Stop codon!

Chart in pdf

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 17:30
Agene in a type of bacteria when the ses bacteria reproduce asexually this mutation can only be inherited by
Answers: 1
question
Biology, 22.06.2019 00:30
The location of the stomach is the diaprham
Answers: 1
question
Biology, 22.06.2019 04:30
African penguins, which inhabit the coasts of southern africa, were classified as an endangered species in 2010. two significant threats to their survival are ecosystem damage from oil spills and overfishing by humans. overfishing depletes the food supply of african penguins. the best method to reduce the threat of overfishing would be to . the risk of oil spills could be reduced by increasing the use of , which should oil consumption. if an oil spill does occur, could be used to remove the oil so the ecosystem may more quickly recover.
Answers: 2
question
Biology, 22.06.2019 05:30
Identify the composition of oceanic and continental crystal rocks.in a model of earth’s interior,where would these rocks appear?
Answers: 2
You know the right answer?
Need help look at pdf/link part 5. a b and c 1. Use this sequence of DNA to answer the following f...
Questions
question
Mathematics, 20.05.2020 15:57
question
Biology, 20.05.2020 15:57
question
History, 20.05.2020 15:57
question
Geography, 20.05.2020 15:57
Questions on the website: 13722363