Need help look at pdf/link part 5. a b and c
1. Use this sequence of DNA to answer the following former test questions:
5’-- TTAATGGGACAGCTTGTGTAGAGG --3’
a. What is the complementary strand of DNA?
b. Using the complementary strand of DNA (your answer from part a) as the template
strand, what is the transcribed mRNA sequence?
c. What is the amino acid sequence translated from the strand of mRNA synthesized in
part b (use the genetic code below)?
Remember:
i. Start codon!
ii. Stop codon!
Chart in pdf
Answers: 1
Biology, 21.06.2019 17:30
Agene in a type of bacteria when the ses bacteria reproduce asexually this mutation can only be inherited by
Answers: 1
Biology, 22.06.2019 04:30
African penguins, which inhabit the coasts of southern africa, were classified as an endangered species in 2010. two significant threats to their survival are ecosystem damage from oil spills and overfishing by humans. overfishing depletes the food supply of african penguins. the best method to reduce the threat of overfishing would be to . the risk of oil spills could be reduced by increasing the use of , which should oil consumption. if an oil spill does occur, could be used to remove the oil so the ecosystem may more quickly recover.
Answers: 2
Biology, 22.06.2019 05:30
Identify the composition of oceanic and continental crystal rocks.in a model of earth’s interior,where would these rocks appear?
Answers: 2
Need help look at pdf/link part 5. a b and c
1. Use this sequence of DNA to answer the following f...
Health, 20.05.2020 14:58
Mathematics, 20.05.2020 15:57
Biology, 20.05.2020 15:57
Engineering, 20.05.2020 15:57
Biology, 20.05.2020 15:57
Mathematics, 20.05.2020 15:57
Mathematics, 20.05.2020 15:57
Mathematics, 20.05.2020 15:57
Social Studies, 20.05.2020 15:57
Biology, 20.05.2020 15:57
History, 20.05.2020 15:57
Geography, 20.05.2020 15:57
Geography, 20.05.2020 15:57