2. a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 ZPTTGCATCCGAAACGTACGATCGATCGGCCGACT TATTACGATCGGACTACTGCGTCGTAGC5'... ...5AACGTAGGCTTTGCATGCTAGCTAGCCGGCT GAATAATGCTAGCCTGATCACGCAGCATCG3"... (1) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. (1 mark) (Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i). (1 mark)

What's the yellow wallpaper?

This is s cute awee : (( . well if she's showing you signs that she may like you , then shoot your shot ! don't be afraid . & if you're unsure that she's giving you these signs , then wait out for a little bit . most girls are different . some may act really sweet , but only bc you're a good friend of hers . that , or she might like you . you just never know . but i think you should sit down with her & tell her how you feel . but don't be awkward & shy . just be straight up & tell her how you feel . if the feelings aren't mutual , then don't cry about it . you need to respect her decision & look for others in the world . feelings can be difficult & confusing , but don't be afraid to show them . i say you play it out & if you're still unsure about it , talk to her . - rach

As what he you go get the hot dog ; )