Invasive Species Name: Golden Spotted Oak Borer
Describe the impact the invasive species is having on the local ecosystem:
What is it doing to the local/ native wildlife?
What type of controlling mechanism is this group proposing?
Summarize what their solution is:
Will it work? Give an explanation for your reasoning from the information they provide and from your background knowledge
Answers: 1
Biology, 21.06.2019 22:00
Hey me with this oneβ€β€β€β€ every organism needs food. does a cell also need it? explain very briefly.
Answers: 2
Biology, 21.06.2019 23:00
Biomass can be used to generate electricity. biomass relies heavily on agricultural crops. plants release carbon dioxide and water in combustion. plants use photosynthesis to originally generate the energy that is needed. the chemical energy of these plants all started with what energy source?
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:20
Which of the following determines the specificity of a dna probe? a. type of radiation b. level of enzymatic activity c. number of neutrons d. complementary base pairing
Answers: 1
Invasive Species Name: Golden Spotted Oak Borer
Describe the impact the invasive species is having...
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01
Mathematics, 17.09.2020 04:01