Is KBr ionic, polar covalent or nonpolar covalent

In german cockroaches, curved wing (cv) is recessive to normal wing (cv+). bill, who is raising cockroaches in his dorm room, finds that the frequency of the gene for curved wings in his cockroach population is 0.6. in his friend joe’s apartment, the frequency of the gene for curved wings is 0.2. one day joe visits bill in his dorm room, and several cockroaches jump out of joe’s hair and join the population in bill’s room. bill estimates that, now, 10% of the cockroaches in his dorm room are individual roaches that jumped out of joe’s hair. what is the new frequency of curved wings among cockroaches in bill’s room? 0.69 0.4 0.5 0.31 0.20

Resperation is a way to release carbon back into the atmosphere

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?