Has the code for traits:
Carbs
Lipids
Proteins
Nucleic acids...
![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:00
Toorale man murder mystery < - your lab link 1. how was the toorale man found? 2. what did archaeologists learn about the burial? why is the burial important? 3. what information were the scientists able to learn from the skeleton itself? 4. why is the question of whether the injuries came from a stone or steel weapon important? how could scientists distinguish between the different types of weapons? 5. what did the carbon dating and soil testing tell scientists about toorale man? why are the dates interesting for scientists?
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:10
Select the correct answer.what is the observable characteristic of a person called? o a. genotypephenotypeoc.alleleo d.gene
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:00
The sea slug that considered to be a photosyntheesizing animal
Answers: 2
You know the right answer?
Questions
![question](/tpl/images/cats/istoriya.png)
History, 04.01.2021 20:50
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 04.01.2021 20:50
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/pravo.png)
Law, 04.01.2021 20:50
![question](/tpl/images/cats/mkx.png)
Arts, 04.01.2021 20:50
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.01.2021 20:50
![question](/tpl/images/cats/biologiya.png)
Biology, 04.01.2021 20:50
![question](/tpl/images/cats/istoriya.png)
History, 04.01.2021 20:50
![question](/tpl/images/cats/en.png)
English, 04.01.2021 20:50
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 04.01.2021 20:50
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.01.2021 20:50
![question](/tpl/images/cats/User.png)
Engineering, 04.01.2021 20:50
![question](/tpl/images/cats/mat.png)
Mathematics, 04.01.2021 20:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.01.2021 20:50