Biology, 23.08.2021 20:00 miastrick19
A population of Poison dart frogs can be red (RR), orange (Rr) or yellow (rr). The allele frequency of the mainland is R: 0.5 r: 0.5. A small group of the frogs moves to an island off the mainland. If the group is composed of 4 red and one orange frog, what would you expect to happen to the allele frequency?
Answers: 1
Biology, 21.06.2019 22:20
Hummingbirds drink nectar from flowers, while robins eat plant seeds. what does this reduce?
Answers: 2
Biology, 22.06.2019 08:30
What do isotopes of uranium have the same number of? what do they have a different number of? a) same number of protons; different number of electrons b) same number of protons; different number of neutrons c) same number of electrons; different number of protons d) same number of neutrons; different number of protons
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:10
Match the correct terms to their descriptions a system in which only energy but not matter is exchanged frozen water in snow part of geosphere that includes only soil a thin layer between the troposphere and the stratosphere cryosphere tropopause closed system pedosphere
Answers: 2
A population of Poison dart frogs can be red (RR), orange (Rr) or yellow (rr). The allele frequency...
Mathematics, 19.05.2020 04:02
Computers and Technology, 19.05.2020 04:02
Mathematics, 19.05.2020 04:02
English, 19.05.2020 04:02
Advanced Placement (AP), 19.05.2020 04:02
Mathematics, 19.05.2020 04:02
Mathematics, 19.05.2020 04:02
Chemistry, 19.05.2020 04:02
Mathematics, 19.05.2020 04:02
Chemistry, 19.05.2020 04:02
Mathematics, 19.05.2020 04:02
History, 19.05.2020 04:02
Mathematics, 19.05.2020 04:02