Transcribe the following gene into mRNA: TACGCGTAATCACGTCCTGTCATC

What is the name of the two satelites on mars

Hedgerows have created a new ecosystem within britain’s a. farms b. cities c. forests d. industrial areas

Research cheetahs on the internet what has contributed to this animal becoming "endangered" or "threatened." what animal you have chosen? -cheetah how long has the animal been endangered or threatened? what has contributed to this animal’s endangered or threatened status? why is it important to save this animal from extinction? after researching and gathering facts, write a 350-word letter from the point of view of an animal rights' activist. be sure to include at least five facts that you learned from your research.