subject
Biology, 16.08.2021 20:50 kharmaculpepper

rerddit Researchers determined that, at 25°C, the rate constant for the binding of PLX 2021 to the B-Raf kinase domain ATP binding pocket is 2 x 10–2 M–1s–1. Given this, the rate constant for the dissociation of PLX 2021 from the B-Raf kinase domain ATP binding pocket is nearest what value?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 10:50
What is it called when part of a cell membrane closes around a molecule to allow the molecule to enter the cell? a. passive transport b.diffusion c. endocytosis d. exocytosisc. endocytosis
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 20:40
Lumps of iron and manganese ore called can be harvested from the seafloor near underwater volcanoes.
Answers: 1
question
Biology, 23.06.2019 04:00
Researchers studying a small milkweed population note that some plants produce a toxin and other plants do not. they identify the gene responsible for toxin production. the dominant allele (t) codes for an enzyme that makes the toxin, and the recessive allele (t) codes for a nonfunctional enzyme that cannot produce the toxin. heterozygotes produce an intermediate amount of toxin. the genotypes of all individuals in the population are determined (see chart) and used to determine the actual allele frequencies in the population.is this population in hardy-weinberg equilibrium? a) yes.b) no; there are more homozygotes than expected.c) no; there are more heterozygotes than expected.d) more information is needed to answer this question.
Answers: 2
You know the right answer?
rerddit Researchers determined that, at 25°C, the rate constant for the binding of PLX 2021 to the B...
Questions
Questions on the website: 13722361