Answers: 3
Biology, 22.06.2019 02:30
Suppose you have monohybrid pea plants in your garden and find that they produce round seed to wrinkled seeds in the ratio of 3: 1. if the allele are designated (r & r) receptively. what is the probable genotypes of the round seeds which produced f 1 ? rr & rr rr only rr & rr rr only rr only
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30
Which of the following observation darwin shape his concept of descent with modification? a) species diversity declines farther from the equator. b) fewer species live on islands than on the nearest continents. c) birds live on islands located farther from the mainland than the bird's maximum nonstop flight distance. d) south american temperate plants are more similar to the tropical plants of south america than to the temperate plants of europe. e) earthquakes reshape life by causing mass extinctions.
Answers: 1
Biology, 22.06.2019 17:20
Can yall plz me on this question im having a hard time think about it
Answers: 1
Classifique os tipos de energia que predominam nos fenômenos descritos abaixo.
a) Uma bola rolando...
Mathematics, 25.11.2019 03:31
Physics, 25.11.2019 03:31
Mathematics, 25.11.2019 03:31
English, 25.11.2019 03:31
Mathematics, 25.11.2019 03:31
History, 25.11.2019 03:31
Mathematics, 25.11.2019 03:31
English, 25.11.2019 03:31
Mathematics, 25.11.2019 03:31