subject
Biology, 03.08.2021 03:50 edfrank6278

Compare the use of hormones as chemical messengers in plants and animals. Both plants and animals use glands to produce and secrete hormones.
Many of a plant's hormones are secreted into the air, while many of an animal's hormones are secreted into the blood.
Many of a plant's hormones are secreted into intercellular fluid, while many of an animal's hormones are secreted into the blood.
Plants do not use hormones as chemical messengers, but animals do.

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 06:30
Explain how scientists use geologic time to determine the age of landforms.
Answers: 1
question
Biology, 22.06.2019 07:00
The is an estimate of the fewest number of organisms a population needs to avoid extinction. this measurement will most if the number of offspring each female in the population produces increases. if the population's this measurement will most likely increase. 1 population density, minimum viable population, carrying capacity 2 decrease, be unaffected, increase 3 death rate increase, dead rate decrease
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:20
First idea: suddenly, women were leaving their homes to cycle and socialize on country roads and city streets. —wheels of change, sue macy second idea: it was not a stretch for some cyclists to see the possibility of a larger role for women in the world. —wheels of change, sue macy what type of graphic organizer would best represent the connection between these two ideas? 1) a t-chart that separates ideas into two different categories 2) a chronology that shows 3) a sequence of several events a cause-and-effect graphic that shows how one idea led to another 4)a problem-solution graphic that presents a problem and a solution to the problem
Answers: 2
You know the right answer?
Compare the use of hormones as chemical messengers in plants and animals. Both plants and animals u...
Questions
question
Social Studies, 10.12.2021 04:50
question
Mathematics, 10.12.2021 04:50
question
English, 10.12.2021 04:50
question
Mathematics, 10.12.2021 04:50
question
Mathematics, 10.12.2021 04:50
Questions on the website: 13722362