Answers: 1
Biology, 21.06.2019 20:00
Can you identify which of the following groups of organisms are, or are not, populations? a. the american bison (bison bison) and grey wolves (canis lupus) currently living in yellowstone national parkb. all of the rainbow trout (oncorhynchus mykiss that) that have ever lived in lake eriec. the group of american bison (bison bison) currently living in yellowstone national parkd. a group of calliope hummingbirds (selasphorus calliope) and a group of rufous hummingbirds (selasphorus rufus) living in the same new hampshire woodse. the northern cardinals (cardinalis cardinalis) living on opposite shores of lake champlain f. all of the whales currently living in the atlantic ocean off cape cod, massachusetts
Answers: 1
Biology, 22.06.2019 08:50
You are observing different types of cells in your science lab. one cell has many chloroplasts. what is the most likely function of this cell? a. energy production b. photosynthesis c. reproduction d. digestion
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:20
Which of the following is an advantage of using embryonic stem cells in medical research? a. the use of embryonic stem cells is much less expensive than the use of adult stem cells. o b. no living tissue is damaged when scientists use embryonic stem cells. o c. embryonic stem cells are able to differentiate into a wider range of cells than adult stem cells. d. there is no controversy surrounding the use of embryonic stem cells.
Answers: 3
The image shows a nucleotide a building block of the dna molecule. From left to right what are the n...
Mathematics, 22.07.2021 04:10
Biology, 22.07.2021 04:10
Mathematics, 22.07.2021 04:10
Mathematics, 22.07.2021 04:10
Health, 22.07.2021 04:10
Mathematics, 22.07.2021 04:10
Mathematics, 22.07.2021 04:10
Physics, 22.07.2021 04:10
Chemistry, 22.07.2021 04:10