Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

This is the main structural axis of the plant that supports leaves, flowers and fruits; transports fluids; stores nutrients and produces new tissue.

Which statement describes how favorable traits in a population relate to natural selection? they are the only traits that ever exist in the population. they build in the population over time. they are rarely passed on to offspring. they are found only in a few individuals within the population.

The punnett square predicts the ratio of genotypes in the offspring, based on the genotypes of the parents. in this cross, tallness (h) is dominant to shortness (h). based on the punnett square, what is the phenotype of the offspring? hh hh tall short