Biology, 10.05.2021 22:00 courtnicollee
1. What's different from Microevolution versus macroevolution?
Answers: 1
Biology, 22.06.2019 09:30
Parthenogenesis is a type of reproduction that does not require a mate. it’s rarely seen in birds and higher vertebrates. parthenogenesis involves the formation of a zygote. but this zygote is formed without fertilization. in parthenogenesis, in the absence of a male gamete, the ovum develops directly in the zygote.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:00
In cattle a single gene with two alleles determines fur color the fur can be red white or roan roan fur has both red and white hair which of the following statements is true a the allele for roan fur color is dominant over red and white fur color b the allele for red fur color is dominant over white and roan fur color c the roan and white alleles are expressed independently of the other d the red and white alleles are expressed independently of each other
Answers: 1
1. What's different from Microevolution versus macroevolution?...
English, 02.07.2020 09:01
English, 02.07.2020 09:01
Mathematics, 02.07.2020 09:01
Mathematics, 02.07.2020 09:01
Chemistry, 02.07.2020 09:01