![subject](/tpl/images/cats/biologiya.png)
Two other puppies from the same litter had their HLA-DQA1 genes tested. Their results are below. Based on the evidence provided would you predict that the shape of the protein related to the HLA-DQA1 gene will be the same for Puppy 1 and Puppy 2? Explain why or why not?
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:30
Is a measure of the different types of organisms in a community. question options: tertiary secondary primary none of the above
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 19:00
Ruby is conducting an investigation. an advantage of her design is that she can use a large range of variables, with that she can not be sure that one variable is the cause of another. what kind of investigation is ruby most likely conducting?
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 20:30
Which factor is difficult to assess in a cost-benefit analysis
Answers: 1
You know the right answer?
Two other puppies from the same litter had their HLA-DQA1 genes tested. Their results are below.
B...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.11.2020 21:00
![question](/tpl/images/cats/mat.png)
Mathematics, 12.11.2020 21:00
![question](/tpl/images/cats/es.png)
Spanish, 12.11.2020 21:00
![question](/tpl/images/cats/mat.png)
Mathematics, 12.11.2020 21:00
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 12.11.2020 21:00
![question](/tpl/images/cats/mat.png)
Mathematics, 12.11.2020 21:00
![question](/tpl/images/cats/mat.png)
Mathematics, 12.11.2020 21:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.11.2020 21:00
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.11.2020 21:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 12.11.2020 21:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 12.11.2020 21:00