![subject](/tpl/images/cats/biologiya.png)
Biology, 30.04.2021 20:30 cxttiemsp021
Some solar power plants use mirrors to focus sunlight on a
central collector. The energy from sunlight causes water in the
central collector to boil and produce steam. A generator uses
the kinetic energy of the steam to produce electrical energy.
How could a thermal battery help this type of power plant
generate electrical energy 24 hours per day?
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:00
In eukaryotes, genetic information is passed to the next generation by processes that include mitosis or meiosis. which of the explanations identifies the correct process and supports the claim that heritable information is passed from one generation to another? a. mitosis, followed by cytokinesis, produces daughter cells that are genetically different from the parent cell, thus insuring variation within the population. b. during mitosis, dna replication occurs twice within the cell cycle to insure a full set of chromosomes within each of the daughter cells produced. c. in asexual reproduction, a single individual is the sole parent and passes copies of its genes to its offspring without the fusion of gametes. d. single-celled organisms can fuse their cells, reproducing asexually through mitosis to form new cells that are not identical to the parent cell.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 00:30
Building glycogen from glucose molecules is an example of what
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:10
The normal shape of an enzyme is as shown in structure a. if the enzyme’s shape changes to that shown in structure b, what are two consequences of this change?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Some solar power plants use mirrors to focus sunlight on a
central collector. The energy from sunl...
Questions
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 25.04.2020 03:52
![question](/tpl/images/cats/mat.png)
Mathematics, 25.04.2020 03:52
![question](/tpl/images/cats/en.png)
English, 25.04.2020 03:52
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 25.04.2020 03:53
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 25.04.2020 03:53
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 25.04.2020 03:53
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
History, 25.04.2020 03:53