Human blood type is determined by three alleles IA, IB, and IO. The alleles IA and IB are co-dominant to each other, and both are dominant to IO. Within a large, randomly mating population (540,000 individuals), the frequencies for the blood type alleles are 0.3 for the IA allele, 0.6 for the IO allele, and 0.1 for the IB allele. Calculate the expected numbers of people in the population having the blood type of A.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

In a leaf, dermal tissue a) stores food b) stores carbon dioxide c) releases oxygen into the air d) transports water from the roots

When are the centromeres broken in meiosis?