The arthropods are the most successful group of animals; several key features explain their success. Check all of the features that one would use to classify members into this phylum. Check All That Apply Growth takes place through ecdysisGrowth takes place through ecdysis A rigid exoskeleton made of chitinA rigid exoskeleton made of chitin Closed circulatory systemsClosed circulatory systems Jointed appendagesJointed appendages A rigid exoskeleton made of keratinA rigid exoskeleton made of keratin Segments specialized into functional tagmataSegments specialized into functional tagmata

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Dna replication occurs in preparation for

Modern computers can store about as much information as the human brain. true false its false i took the test