subject
Biology, 29.04.2021 21:00 smithsa10630

The picture shows a plant's vascular bundle. Vascular Bundle
Which is the function of the vascular bundle in plants?
F the respiration of gases
G the accumulation of starches
H the production of cork and pith cells
) the conduction of water and nutrients

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 17:30
Why is a dominant allele called dominant
Answers: 1
question
Biology, 21.06.2019 23:00
Rue or false siblings look simila rbecause they each have some traits of their parents.
Answers: 2
question
Biology, 22.06.2019 06:30
What molecule does hemoglobin decay into over time
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
The picture shows a plant's vascular bundle. Vascular Bundle
Which is the function of the va...
Questions
question
Mathematics, 19.09.2019 12:30
question
English, 19.09.2019 12:30
question
Mathematics, 19.09.2019 12:30
Questions on the website: 13722363