PLEASE HELP BIOLOGY.
...
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:30
The hardy-weinberg principle is that genetic frequencies in a population? will remain stable from generation to generation will always be changing will not be affected by environmental changes are always in a 3: 1 ratio
Answers: 3
Biology, 22.06.2019 17:10
In cellular biology, what is the definition of the word specialized? te o a. carried across the cell membrane by a specific protein a o b. a structure within a eukaryotic cell that performs a specific function o c. adapted to a specific function or condition es essere beste ser bendere s b tele ee o d. containing unique dna ser eeseen les, e nde este ses see ste submit e
Answers: 1
Mathematics, 20.05.2021 21:50
Mathematics, 20.05.2021 21:50
Social Studies, 20.05.2021 21:50
Mathematics, 20.05.2021 21:50
Chemistry, 20.05.2021 21:50
Arts, 20.05.2021 21:50
Mathematics, 20.05.2021 21:50
English, 20.05.2021 21:50
English, 20.05.2021 21:50
Mathematics, 20.05.2021 21:50