Biology, 02.10.2019 09:30 SumayahAminaAnsari

Which of the following nitrogen bases in unique to rna?
uracil
thymine
cytosine

Answers: 2

Show answers

Another question on Biology

Biology, 21.06.2019 22:00

Where would you expect to see seedless plants, such as ferns and mosses? a. in a botanical museum, because they are all extinct b. low and close to the ground in a moist environment c. climbing high while circling the branches of another plant d. deeply rooted in a forest with a trunk that reaches 20 meters or more

Answers: 1

Answer

Biology, 22.06.2019 03:00

Which of the following are the ingredients that go into the plant and are needed for photosynthesis? select all that apply. 1.) soil 2.) seeds 3.) carbon dioxide 4.) minerals 5.) glucose (sugar) 6.) water 7.) light energy (sunlight) 8.) oxygen 9.) air

Answers: 2

Answer

Biology, 22.06.2019 10:30

What is the main reason that attitudes are more often revealed in spoken rather than written language? a. in writing, we try to put the "best face" on what we write. b. we speak far more often than we write. c. in writing, we can more easily conceal our attitudes. d. in spoken language, we are often careless in our use of words.

Answers: 2

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Which of the following nitrogen bases in unique to rna?
uracil
thymine
cytosine...

Questions