Biology, 18.10.2019 23:50 davelopez979
Many different feedback mechanisms have evolved over time. these mechanisms allow an organism to respond to changes in both its internal and external environment. select an organism from those you have learned about and using one or more complete sentences, describe how a specific feedback process works within that organism. include how the feedback specifically the organism maintain homeostasis.
Answers: 1
Biology, 22.06.2019 11:30
According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Many different feedback mechanisms have evolved over time. these mechanisms allow an organism to res...
Mathematics, 21.09.2020 02:01
History, 21.09.2020 02:01
Biology, 21.09.2020 02:01
History, 21.09.2020 02:01
Mathematics, 21.09.2020 02:01