subject
Biology, 05.01.2020 20:31 Will1119

Which of the following descriptions applies to a virus? a. a living thing b. a packet of dna or rna that isn't really alive c. a single celled-organism d. the smallest cell

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 00:40
World class speed skaters can skate a 3,000-m course in about 4 minutes. what is their average speed for this course. a. 12.5m/s b. 1.33m/s c. 13.3m/s d. 1.25m/s
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
When rutherford performed his metal foil experiment, he was surprised that most of the alpha particles
Answers: 1
question
Biology, 22.06.2019 16:30
How to farmers could ensure that they only grow white flowers
Answers: 1
You know the right answer?
Which of the following descriptions applies to a virus? a. a living thing b. a packet of dna or rna...
Questions
question
Mathematics, 10.06.2021 17:20
question
Mathematics, 10.06.2021 17:20
question
French, 10.06.2021 17:20
question
Mathematics, 10.06.2021 17:20
Questions on the website: 13722361