Biology, 25.08.2019 02:00 zombieslayas8500
An mrna is 429 nucleotides long. the number of amino acids in the polypeptide chain formed from this mrna is
(a) 143.
(b) 142.
(c) 141.
(d) 429.
(e) 428.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:00
Why is it to call the calvin cycle the light independent reactions vs the dark reactions
Answers: 3
Biology, 22.06.2019 20:00
Based on the observations provided, what is the relationship of current diabetes medication use and the use of extract from ginko biloba? a) the anti-inflammatory properties of ginko biloba extract are beneficial in treating t2d separate from the benefits of other therapies. b) the overall abundance of ginko biloba makes this extract an attractive joint therapy for existing medications that are used to treat t2d. c) the side effects of t2d medications have resulted in the need for different therapies to treat t2d like the use of ginko biloba extract. d) clinical outcomes from the use of current t2d medications may be improved through the use of cost-effective ginko biloba extract treatment. e) previous studies with ginko biloba and current t2d medications do not support the use of these treatments as effective against t2d in patients.
Answers: 3
Biology, 23.06.2019 07:00
Which statement about adolescence is false? ? a. teens learn to solve problems and make decisions in a mature wayb. teens consider the consequences of their actionsc. teens take a greater responsibility in the household and communityd. teens focus on how to contribute to the worldplzzz hurry need rt away
Answers: 2
An mrna is 429 nucleotides long. the number of amino acids in the polypeptide chain formed from this...
Arts, 17.07.2019 07:30
Chemistry, 17.07.2019 07:30
Social Studies, 17.07.2019 07:30
Biology, 17.07.2019 07:30
Business, 17.07.2019 07:30
Health, 17.07.2019 07:30
Mathematics, 17.07.2019 07:30
Social Studies, 17.07.2019 07:30
Social Studies, 17.07.2019 07:30
Social Studies, 17.07.2019 07:30
Business, 17.07.2019 07:30