subject
Biology, 22.09.2019 14:20 gabbys2002

If you had four blue cards, four red cards, and four yellow cards in a deck, what are the chances of drawing a blue card on your first try?

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 01:00
Put the following processes of protein synthesis in the correct order: - dna strands unwind and separate - mrna copies dna according to complimentary base pairing - trna's anticodons bring amino acids to the corresponding mrna codons - amino acids bind to each other making a protein - mrna leaves the nucleus - a stop codon is reached, the newly formed protein is released to go do its job for the cell
Answers: 1
question
Biology, 22.06.2019 06:30
Which of the following is a common response to cell signaling?
Answers: 2
question
Biology, 22.06.2019 09:30
2. does the given statement describe a step in the transformation of the graph off(x) = x2 that would result in the graph of g(x) = -5x + 2)? a. the parent function is reflected across the x-axis. o yes nob. the parent function is stretched by a factor of 5. yes noonc. the parent function is translated 2 units up.o yes
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
If you had four blue cards, four red cards, and four yellow cards in a deck, what are the chances of...
Questions
question
Mathematics, 18.12.2019 08:31
question
Biology, 18.12.2019 08:31
question
History, 18.12.2019 08:31
Questions on the website: 13722367