Photosynthesis is the process by which green plants use solar energy to convert simple substances into complex ones that contain energy.

In eukaryotes, genetic information is passed to the next generation by processes that include mitosis or meiosis. which of the explanations identifies the correct process and supports the claim that heritable information is passed from one generation to another? a. mitosis, followed by cytokinesis, produces daughter cells that are genetically different from the parent cell, thus insuring variation within the population. b. during mitosis, dna replication occurs twice within the cell cycle to insure a full set of chromosomes within each of the daughter cells produced. c. in asexual reproduction, a single individual is the sole parent and passes copies of its genes to its offspring without the fusion of gametes. d. single-celled organisms can fuse their cells, reproducing asexually through mitosis to form new cells that are not identical to the parent cell.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Drag the tiles to the correct boxes to complete the pairs. match each cell organelle with its description.