Answers: 1
Biology, 22.06.2019 02:20
Astudent analyzed ears of corn that demonstrated two traits in the f2 kernels, purple or white colors and smooth on wrinkled shapes. a tabulation of 135 individual kernels gave the following results: purple and smooth = 75 white and smooth = 28 purple and wrinkled = 24 white and wrinkled = 8 what would be the only phenotype present in the f1 ger
Answers: 3
Biology, 22.06.2019 09:00
Select all that apply genes are specific nucleotide sequences occur in numbers that are the same as the number of chromosomes are located in a specific place on a chromosome determine the traits of an organism are units of rna
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Afox is a type of mammal that is related to dogs. how does a fox most likely respond to hot air temp...
Mathematics, 13.11.2020 08:00
Mathematics, 13.11.2020 08:00
Mathematics, 13.11.2020 08:00
Mathematics, 13.11.2020 08:00
Social Studies, 13.11.2020 08:00
Mathematics, 13.11.2020 08:00
Advanced Placement (AP), 13.11.2020 08:00
Chemistry, 13.11.2020 08:00
Health, 13.11.2020 08:00
Health, 13.11.2020 08:00
Chemistry, 13.11.2020 08:00
Mathematics, 13.11.2020 08:00