Place the following terms in the correct order from smallest to largest:
nucleosome, s...
![subject](/tpl/images/cats/biologiya.png)
Biology, 26.09.2019 07:30 omarabdellbast4334
Place the following terms in the correct order from smallest to largest:
nucleosome, supercoil, coil, chromosome and dna double helix
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:40
For the strategies below, decide whether they are best described as demand-side solutions or supply-side solutions to meeting human needs for fresh water. remember that a demand-side solution reduces demand for fresh water, whereas a supply-side solution increases the supply of fresh water. (a) damming a river to create a reservoir (b) desalinating seawater (c) a nation invading a neighboring country to access their rivers (d) raising water prices for consumers and businesses (e) providing tax breaks for companies that use less water (f) replacing inefficient irrigation with more-efficient drip irrigation to grow crops (g) requiring low-flow showerheads in all new homes
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:30
Describe the relationship between isotonic solutions, equilibrium, and water movement into and out of a cell.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 21:00
What is the net atp production at this stage of cellular respiration? 2atp aatp 32 atp 36 atp
Answers: 3
You know the right answer?
Questions
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 30.11.2021 05:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 30.11.2021 05:50
![question](/tpl/images/cats/User.png)
SAT, 30.11.2021 05:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 30.11.2021 05:50
![question](/tpl/images/cats/mat.png)
Mathematics, 30.11.2021 05:50
![question](/tpl/images/cats/mat.png)
Mathematics, 30.11.2021 05:50
![question](/tpl/images/cats/mat.png)
Mathematics, 30.11.2021 05:50
![question](/tpl/images/cats/User.png)
SAT, 30.11.2021 05:50
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 30.11.2021 05:50
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/User.png)
SAT, 30.11.2021 05:50
![question](/tpl/images/cats/User.png)
SAT, 30.11.2021 05:50
![question](/tpl/images/cats/mat.png)
Mathematics, 30.11.2021 05:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)